Cryptozoology vs. Cameras I: Zoom! Enhance!

This will be a recurring series that technically and stylistically critiques photographs of cryptids (and any other such pseudoscience, minus the alliteration). I will offer snarky amateur suggestions on how to sharpen up your blobsquatches. Hopefully, this will contribute to a dramatic uptick in the quality of cryptid photographic evidence, unless of course these creatures only exist in a paridollic world of ambiguous pixels.

Today’s photo: Nessie, by Richard Preston:

© Richard Preston

Context

According to STV News, Richard Preston, a landscape engineer working on the grounds of Aldourie Castle on the shores of Loch Ness in 2010, saw something strange out in the Loch. He fired off a few photos of some white bumps out in the water which were widely distributed in the UK and around the world.

“I was just walking through the castle gardens and I spotted something in the distance. When I looked closer I could clearly see the four hump-like features. I thought I’d take a picture of it, to see if there was anything in it, to see what others thought.

“I was surprised that it stayed there as long as it did. I took various shots of it before it suddenly disappeared. I literally just turned my back and it was gone.”

Now, let’s talk about the photo.

Technical (D-)
Ouch! Where to start here. The colors are over saturated, contrast is way to high, and the resolution is for shite thanks to obvious and extreme over magnification and processing of the original image. Whatever photo processing software that was used on this image is not quite up to CSI’s imaginary image manipulation technology. The point being that the “Zoom in. Now enhance.” cliche is nonsensical. In digital photos you can’t create pixel information where there isn’t any to begin with, and “enhancement” techniques actually destroy information and insert artifacts into an image. I can’t really say much beyond that; the poor quality of this shot actually makes the critique of it mercifully brief.

Stylistic (C)
Yuck. The subject is in the dead center of the frame, and there is no attempt to follow, or creatively transcend, the rule of thirds. The awful post-pressing, however, adds a slightly surreal element to the photograph that is befitting its alleged aquatic subject. Also, the autumn foliage is pretty.

Irrefutability (D)
The obvious manipulation of every other aspect of this photo makes it fairly poor evidence of a freshwater plesiosaur living in Loch Ness. The white bumps could have been intentionally added digitally, or arose from an everyday object on the lake being blasted into ambiguity through enhancement. This, or the myriad other pixelated lake-bump photos, does not help overcome the problems of a population of enormous, air breathing animals living in an isolated body of water surrounded by human civilization, without leaving a single piece of physical evidence over thousands of years.

My Serious Take
The image I posted above is obviously not the original photo taken by Richard Preston, though it is the most widely circulated around the web and in print publications. Here is the originally framed image, with the above crop indicated with by a rectangle:

© Richard Preston

And here is a second shot, taken from a slightly different position (based upon the foreground shrubs location in respect the house):

© Richard Preston

I can’t really conclude a whole lot from these shots, mostly since I can’t find them in their original resolution. However, if the widely circulated image at the top of the page is any indication of how informative they are at higher resolution, I would say they are pretty weak evidence of anything. Maybe it’s a wave. Maybe it’s a pod of albino otters. Maybe it’s Nessie. Scientifically, these photos are as useful as an anecdote, and unexplained ambiguity is proof of nothing.

Advice
Buy this:

For the super-affordable price of $5999.95!

Not only will the 800 mm focal length of the Sigmonster get you up close and personal with Nessie, if the beast attacks this lens can double as a bludgeon.

There’s a new monster in this Loch.

YEAHHHHHHHH

Posted in Cryptozoology | Tagged , , , | Leave a comment

Why do cryptozoologists hate arthropods?

Considering their diversity and ecological dominance of the planet, arthropods are conspicuously absent in the cryptid world. It seems most ‘serious’ cryptozoologists have a massive chordate megafauna fetish. Even other invertebrate groups have some highly notable cryptids: The mollusks have the kraken, and annelids have giant, lightning-crapping Mongolian death-worms (possibly the most awesomely-ridiculous cryptid ever)… but where are the arthropods?

Here are the sparse few examples of marine arthropod cryptids I could come up with:

Con Rit, the giant sea centipede.

Con Rít (Giant sea centipede): This obscure cryptid is the best example I found, and seems to be an amalgam of every sea serpent ever reported to have a thin, segmented body. Some eye witnesses place it at over 150 feet in length, possessing many armored segments, each with lateral projecting plates. Con Rit has allegedly been sited in many tropical waters throughout to Atlantic, Mediterranean, Indonesia, and South East Asia. Explanations of this creature’s nature range from misidentified oarfish (likely), to giant surviving Eurypterid sea scorpions (slim), or whale-like Basilosaurids with armor plating (ridiculous). Even cryptozoologists admit that the rarity of good sightings and any hard evidence makes Con Rit one of the most unlikely sea serpents to exist. You can read more about this criptid here.

Modern trilobites: Cryptozoology and creationism are often tightly intermarried. Creationists have a strange and misinformed notion that if they can discover living animals from groups that scientists consider to be extinct, they will somehow prove that the earth is only 6000 years old and that animals don’t evolve. These creationists are especially interested in dinosaur-like cryptids including plesiosaurs (Nessie, ect.) and sauropods (Mokele-mbembe). Some of these creationist-types also insist that a variety of misidentified arthropods are, in fact, living trilobites. According to these goofballs; isopods, water penny beetle larvae, and tadpole shrimp are all trilobites, therefore: Jesus! – or something.

A) Trilobite. B) Trilobite. C) Trilobite

Trilobites apparently went extinct 250 million years ago, disappearing from the fossil record during the Permian mass extinction. It is unlikely (unfortunately) that they persist today in small, remote populations – as is the case with the coelacanth. Even if living trilobites are discovered, it would not disprove evolution; the new discovery would only mean that archeologists missed something, and trilobites would be seamlessly integrated into current evolutionary theory – as the modern coelacanths were.

Unusually large variant of arthropod X: Giagantified versions of well known animals are a common theme in the cryptozoological world. It seems that in super-sized America, something is a lot more interesting if it is bigger and more extreme(!). This trend even includes a few arthropod cryptids; giant spiders, giant bees, and giant crustaceans (possibly the vocalists behind the bloop). However, there are serious problems with gigantism in arthropods. Their respiratory and circulatory physiology can be incredibly limiting to attaining large sizes. Therefore, as noticed previously by Entophile, one reason that there are so few arthropod cryptids may be because they do not reach large enough proportions to interest the general public.

That brings us back to the question: Why do cryptozoologists hate arthropods? Despite the fact that arthropods represent nearly 80 percent of know animal life, and the constant discovery of previously-undescribed arthropods by biologists (real scientists discover new animals all the time); it was not easy to come up with the few examples of crunchy cryptids that I mentioned above. I think that the answer to my question lies within the integral nature of cryptooolzgy. I feel that cryptooolzgy is largely a form of zoology deficient in scholarship, logic, and rigor; and the people that accept the mantle of ‘cryptozoologist’ are not professional researchers, but rather enthusiasts participating in a popular cultural movement.

Arthropods do not usually register highly in the zeitgeist of the masses. Most people, and therefore cryptozoologists, prefer their cryptids mysterious and yet easily tangible. If I were to go traipsing around in the woods, attempting to take blurry photographs of the elusive arboreal giant copepod, most people wouldn’t be able to relate in the slightest to my quarry. However, If I am hunting Big Foot, people can easily conjure up the notion of a creature almost identical to a human, only increased in size and follicle density. Or, if I am soliciting funds to travel to the Congo to hunt Mokele-mbembe in the name of Jesus, people can easily identify this creature as a dinosaur, akin to the sauropod form that they are bombarded with as children. Furthermore, this concept also applies to cryptid sightings, as the human brain uses concepts that are familiar in order to comprehend things that are not. Your brain turns floating logs and schools of otters into plesiosaurs, and dark blurs in the woods into Big Foot.

Sadly, for the majority of people, the brain leaves arthropods out.

Giant, blurry arboreal copepods exist, this is proof.

P.S. If you know of, or come across any additional arthropod cryptids please leave a comment!

Posted in Creationism, Cryptozoology | Tagged , , , , | Leave a comment

Creationists love mantis shrimp

The following article was originally posted on Arthropoda on November 24th, 2009. It was only the 5th blog post I ever made, but it is still one of my favorites.

My graduate adviser and some of his collaborators recently published a paper in Nature Photonics, about the efficiency of the natural quarter-wave retarder used in the mantis shrimp’s circularly polarized light detection system. The paper got a lot of play in popular press (because mantis shrimp are awesome), including a write-up by the unintentionally hilarious Institute of Creation Research (ICR). This group has been trying for years to gain Masters of Science Education accreditation in California, and now Texas (this attempt at undermining higher education has astonishingly been denied so far).

Too be fair, their article actually starts off better than most of the popular science writing about these animals. However, after the fifth paragraph it takes a nose-dive into a mire of fairly typical creationist misconceptions and misdirections. The downward spiral begins with a heaping helping of “living-fossil” nonsense.

“The mantis shrimp is also one of many examples of “living fossils”―creatures that have not changed over supposedly vast evolutionary time spans. Some modern mantis shrimps are exactly the same as their ancestors that were fossilized in Devonian strata, which have been assigned an astounding age of 400 million years. The odds of this creature remaining unchanged for that length of time are fantastically remote.”

facepalm-captain-picard

First off, there is no such thing as a living-fossil. This unhelpful term is used by biologists who should know better, repeated incessantly by the popular media, and trumpeted by creationists who use it to shoot holes in good science. Everything alive today has been evolving for exactly as long as everything else. The two species of modern coelacanth, for instance, are not the same as the once successful Devonian lobefin group from which they are derived. They may retain superficial ancient characteristics, but they are completely distinct animals. Likewise, no biologist claims that mantis shrimp have remained unchanged since the Devonian. Mantis shrimp diverged from other crustaceans around the Devonian. Here is a comparison between a fossil and modern mantis shrimp:

A reconstruction sketch of a fossil proto-mantis shrimp (left) versus a modern Squilloid mantis shrimp. The colored arrows demonstrate obvious areas of morphological divergence. Adapted from Schram, 2007 and Ahyong, 2001.

Sure they share some superficial similarities (similarities also shared with thousands of other malacostracan crustaceans, arthropods, bilaterians, metazoans, and so on at a diminishing rate). However, the 500 diverse species of modern mantis shrimp are different animals from their ancient ancestors; with widely variant morphologies and distinct ecologies.

Take, for example, the raptorial appendages (red arrow). The raptorial appendages in modern mantis shrimp are massively enlarged maxillipeds (mouth-parts). These appendages are now highly specialized and used specifically for predation, defense, and competition. You can see that the fossil proto-mantis shrimp does not have an enlarged set of maxillipeds. It took hundreds of millions of years for them to evolve to their modern glory. This evolutionary modification of the first maxillipeds is obvious in the fossil record, and has transformed the ecology of today’s mantis shrimp; making them one of the most voracious and violent predators in the ocean.

The ICR continues,

“And the odds of nature having constructed the world’s most complicated eyes so soon after the “Cambrian Explosion” of life, only to have left them perfectly alone ever since, seems counter-evolutionary.”

The eyes, like the raptorial appendages, obviously did not reach their full complexity when the mantis shrimp diverged in the Devonian. They also took hundreds of millions of years of evolution to develop from their proto-typical form into their elaborate modern design. There is nothing “counter-evolutionary” about the mantis shrimp eye.

“This research had little to say about the origin of the mantis shrimp eye, but it is clear that such high design demands a high designer.”

double-facepalm
Argument from incredulity? Check!

Evolution builds complexity, the currently unknown is not unknowable, and just because we haven’t figured a particular detail out yet doesn’t mean we are going throw our arms in the air and give up. “Vision is complicated and science is hard, therefore God did it,” is a pitiful capitulation.

“While the source of mantis shrimps’ rarefied level of vision is unclear to evolutionists, other researchers, who are not convinced that nature is the only explanatory option for ultimate origins, suspect that the exquisite level of specificity, elegance, and effectiveness in the mantis shrimp vision system testifies to the unsurpassed level of the Creator’s genius.”

The source of stomatopod vision is not unclear to evolutionists. It is obviously the modified product of a suite of evolutionarily conserved visual pigments and optical components. These components are closely related to those in other crustaceans, slightly less related in other arthropods, and present (in some form) in all animals.

Also, I would like to know who these “other researchers” are. I am fairly well immersed in the mantis shrimp literature; it is not a huge research community. Nowhere have I heard a researcher present evidence or submit speculation that mantis shrimp are anything but the product of evolutionary processes. These “other researchers” are not studying the mantis shrimp visual system. They cherry-pick research from real scientists, and throw a creationist spin on it. Actual researchers do not doubt the evolutionary ancestry of the mantis shrimp visual system.

Creationists love mantis shrimp for one of the same reasons that I love them: because they are complicated. Creationists see this complexity, reported to them by actual researchers, and having done no work of their own, declare victory. Scientists also love mantis shrimp for their complexity. They offer unique and exciting opportunities for further research. Research in genetics, evolution, biomechanics, visual ecology, and neurobiology.

Tomorrow, countless scientists will go into their offices, labs, observatories, and field stations. They will work to better understand our world, and communicate that understanding with others. Scientists are driven by the ecstasy that comes with discovery, and they need not doubt that, “somewhere, something incredible is waiting to be known.” -Carl Sagan

References:

  • Roberts N, Chiou T, Marshall N, & Cronin T (2009) A biological quarter-wave retarder with excellent achromaticity in the visible wavelength region Nature Photonics, 3 (11), 641-644 DOI: 10.1038/nphoton.2009.189
  • Ahyong ST (2001) Revision of the Australian stomatopod Crustacea. Records of the Australian
    Museum
    Supplement 26: 1–326.
  • Schram FR (2007) Paleozoic proto-mantis shrimp revisited. Journal of Paleontology 81; 895-916.

Posted in Creationism | Tagged , , | Leave a comment

Poor DNA sequencing does not equal aliens

This was originally an off-topic post on my original blog, Arthropoda, posted in July 2010.

This is a little off topic for the blog theme, but I can’t help a little exercise in pseudoscience deconstruction (especially since it affords me an opportunity to talk a little about cool genetic tools anyone can access and use). This is one of those teachable moments, or rather, a teachable catastrophic and humiliating failure of logic and the application of the scientific method.

Lloyd Pye is an author who believes that humans did not arise via common descent form earlier organisms on earth. Rather, he supports the much more reasonable proposition that early human civilizations were planted on earth by extraterrestrials. To back this up, Mr. Pye thinks he has found the skull of either an alien, or a human-alien hybrid (for now, lets ignore the complete absurdity of hybridizing two organisms with completely unconnected evolutionary pasts).

The 'Starchild' skull: Obviously an alien hybrid and not a deformed human.

The ‘Starchild’ skull was allegedly found in a cave in Mexico 70 years ago. Carbon dating puts it at about 900 years since the individual’s death. DNA testing of the skull by forensic laboratories found an X and Y chromosome, indicating that it belonged to human male from two human parents. In addition, mitochondrial DNA sequencing by another professional laboratory showed that the skull was of Native American ancestry. The skull is likely that of a human child afflicted with hydrocephaly; caused by fluid build up in the cranium that pushes out on the skull and deforms the head as the child develops. For a longer summary of the analyses preformed on the Starchild skull check out this article by Steven Novella.

Since none of the previous scientific analysis indicated that the Starchild was an alien, Lloyd Pye dismisses it out of hand. Recently however, Mr. Pye has announced his own incontrovertible evidence that the Starchid was an alien. Let’s take a look at his evidence, which is apparently so compelling as to justify throwing out the infinitely more reasonable scientific explanations for the Starchild skull.

Are you ready?

This is truly powerful data…

Prepare to have your perceptions of the cosmos and humanity shaken to their very core….

What your’re looking at is an error screen from the BLAST genetic alignment search tool that says:

No significant similarity found. For reasons why, click here

Holy crap!!! I’ve apparently been discovering alien DNA for years! Whenever I get that error, I thought I had simply amplified and sequenced some junk DNA or a aggregation of PCR primers and random genetic material, but no, I (and molecular biologists all around the world) have been discovering countless aliens over the years!

*fiszzzzzit-poof*

Oops! Looks like my sarcasm circuit finally melted down. I guess I’ll explain how BLAST works and how you can end up looking at the error screen above.

BLAST is an extremely useful tool that allows you to search the entire GenBank database (a NIH administrated depository for genetic sequencing data) based on a query DNA or protein sequence. If you isolate and sequence a new gene you can throw it into BLAST, and BLAST will find, and display in order of similarity, all related sequences from GenBank. In this manner you can confirm the the identity of a gene, what type of protein it codes for, or what sort of animal it comes from.

Here, you can even try it. Suppose your sequencing reactions yield this gene fragment:

CCTGTGGTCCTACACAACATGGTGTTATTTCATGACCTTTGTCTTCATCGTCTACTGCT
ACTGGTTCATCGTAGCCGCTGTCAGAAACCACGAGAAGGCCATGAGGGAGCAGGCTAA
GAAGATGGGCGTCAAGTCCCTCCGAGGCGACGCCGACGCTCAGAAGAAGTCTGCCGA
CTGCAAGCTGGCCAAGATCGCCCTCATCAACGTGTCCCTCTGGTTCATGGCCTGGACA
CCCTACACCATGATCAACATCGCCGGATTGACTAACAAGGAAATCGTCACACCTCTCT
TCTCCATCTGGGGTTCCGTCTTGGCCAAGGCAAACACTGTCT

Copy and paste that into the first ‘Query Sequence’ text box on the BLAST page. Make sure the database is set to ‘nucleotide collection (nr/nt)’ and click the ‘BLAST’ button on the bottom. After a bit of processing it will come back with the closest gene sequences to the one you entered. You should find that the sequence is very similar to an opsin gene from the mantis shrimp, Neogonodactylus oerstedii.

Unfortunately, BLAST doesn’t always generate any matches. That could be because you are searching a subset of the full database, the search alignment stringency parameters are too restrictive, or there is something wrong with the DNA sequence you isolated. This happens all the time and is a common discrepancy in the DNA amplification and sequencing process. Here is a portion of one such sequencing result that I obtained a couple years ago when I was trying to find visual genes in a particular mantis shrimp:

ATGTATACAAATGCTGATGGAGTAATAGGAAAGAAAGAAGAGCTGGGAGACTACATTG
TGGGAA

Search this sequence in BLAST exactly as above and you too can discover alien DNA!

So, this is the new ‘stunning’ evidence that Lloyd Pye has uncovered. An unnamed ‘geneticist’ from an unnamed lab or company has amplified an undisclosed DNA gallimaufry, and thrown it into BLAST; yielding an error message that competent scientists see, and disregard, regularly. From this non-result, he makes a dumfounding leap of un-logic to conclude that the Starchild must have been an alien.

Normally, I would feel bad about picking on such an obvious quack. However, Pye makes a living selling this fraudulent Starchild BS, and he rides it into everyone’s living rooms via the unscrupulous ‘science and learning’ television networks. Pye’s Starchild website boasts:

Sadly, and embarrassingly for these networks, this is one of the few pieces of factual information that Pye presents.

Via the SGU podcast.

Posted in Aliens, Pseudoscience | Tagged , , , , , , | Leave a comment